Triple helix conformation-specific blinking of Cy3 in DNA.
نویسندگان
چکیده
We report that Cy3 undergoes triple helix conformation-specific blinking in DNA. Blinking patterns were affected by the stabilization of the Hoogsteen base-pair, suggesting that not only the presence but also the fluctuating behaviour of the triple helix can be monitored by the changes in the Cy3 blinking patterns.
منابع مشابه
A MODEL FOR THE BASIC HELIX- LOOPHELIX MOTIF AND ITS SEQUENCE SPECIFIC RECOGNITION OF DNA
A three dimensional model of the basic Helix-Loop-Helix motif and its sequence specific recognition of DNA is described. The basic-helix I is modeled as a continuous ?-helix because no ?-helix breaking residue is found between the basic region and the first helix. When the basic region of the two peptide monomers are aligned in the successive major groove of the cognate DNA, the hydrophobi...
متن کاملSite-resolved stabilization of a DNA triple helix by magnesium ions.
Proton exchange and NMR spectroscopy have been used to define the effects of Mg2+ ions upon the stability of individual base pairs in the intramolecular parallel triple helix formed by the DNA oligonucleotide d(GAAGAGGTTTTTCCTCTTCTTTTTCTTCTCC). The rates of exchange of individual Watson-Crick and Hoogsteen imino protons in the DNA triple helix were measured in the absence and in the presence of...
متن کاملSequence-specific labeling of superhelical DNA by triple helix formation and psoralen crosslinking.
Site-specific labeling of covalently closed circular DNA was achieved by using triple helix-forming oligonucleotides 10, 11 and 27 nt in length. The sequences consisted exclusively of pyrimidines (C and T) with a reactive psoralen at the 5'-end and a biotin at the 3'-end. The probes were directed to different target sites on the plasmids pUC18 (2686 bp), pUC18/4A (2799 bp) and pUC1 8/4A-H 1 (25...
متن کاملTriple helical DNA in a duplex context and base pair opening
It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson-Crick double helices. A...
متن کاملLocation of cyanine-3 on double-stranded DNA: importance for fluorescence resonance energy transfer studies.
Fluorescence resonance energy transfer provides valuable long-range distance information about macromolecules in solution. Fluorescein and Cy3 are an important donor-acceptor pair of fluorophores; the characteristic Förster length for this pair on DNA is 56 A, so the pair can be used to study relatively long distances. Measurement of FRET efficiency for a series of DNA duplexes terminally label...
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
عنوان ژورنال:
- Chemical communications
دوره 51 23 شماره
صفحات -
تاریخ انتشار 2015